View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16641_low_11 (Length: 256)

Name: NF16641_low_11
Description: NF16641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16641_low_11
NF16641_low_11
[»] chr8 (1 HSPs)
chr8 (7-238)||(10416247-10416478)


Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 238
Target Start/End: Original strand, 10416247 - 10416478
Alignment:
7 gtgagatgaatatctgagtagtaagactcaaaatgggattcaaattcaaaattaattgagctcgcatcctcttcagcgtctccatcctttgcagccgacg 106  Q
    |||| |||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |     
10416247 gtgacatgaatatatgagtagtaagactcgaaatgggattcaaattcagaattaattgagctcgcatcctcttcagcgtctccatcctttgcagccggcc 10416346  T
107 accaacttttgaccgtagagattggagacgccgagaaaatgtggttgcaattatgatgattgtattgcaagtatcgacattcaaaatttgaatatagata 206  Q
     ||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10416347 cccaacttttgaccatagagattggagacgccgagaagatgtggttgcaattatgatgattgtattgcaagtatcgacattcaaaatttgaatatagata 10416446  T
207 gataaaaactggttaagttaaagagtaatgca 238  Q
    ||||||||||||||||||||||||||||||||    
10416447 gataaaaactggttaagttaaagagtaatgca 10416478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University