View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16641_low_15 (Length: 211)
Name: NF16641_low_15
Description: NF16641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16641_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 8 - 195
Target Start/End: Original strand, 812361 - 812546
Alignment:
| Q |
8 |
agtgagatgaatataaaatgaaatgaaatattagtttatatcacaaactaagagaatccgcaatgaatttggagttggtgcattaacttgtgtggcacat |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||| | ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
812361 |
agtgaaatgaatataaaatgaaatgaaatagt--tttatttcacaaactaagagaatccacaatgaatttggagttggtgcattaacttgtgtggcacat |
812458 |
T |
 |
| Q |
108 |
ttactactctcaactgtccgatttggtttaacggctgagatcatacagcttcactaaaactgatgtgtaatcttaacagtctaatctc |
195 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
812459 |
ttacttctctcaactgtccgatttggtttaacggctgagatcatacagcttcactaaaattgatgtgtaatcttaacagtctaatctc |
812546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University