View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16641_low_5 (Length: 392)
Name: NF16641_low_5
Description: NF16641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16641_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 2e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 23 - 228
Target Start/End: Complemental strand, 2851264 - 2851059
Alignment:
| Q |
23 |
gaatctagaatctccactttcttccattcgtttctcgcaatatcctagcatttgaattgcctcctcgtgtttttacttgtatgaatcttcaagttctgca |
122 |
Q |
| |
|
||||| |||||||| |||||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2851264 |
gaatcaagaatctctactttcttacagtcgtttctcgcaatatcctagcagttgaattgcctcctcgtgtttttacttgtatgaatcttcaagttctgaa |
2851165 |
T |
|
| Q |
123 |
tttgaaaaagataatcgtaagagatttcgattttaattttccggttctgaaaattctacgttggaatggtgttgtttacaaaaattgtaaaagtcttgtg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
2851164 |
tttgaaaaagataatcgtaagagatttcgattttaattttccggttctgaaaattctacgttggaatggtgttctttacaaaaatcgtaaaagtcttgtg |
2851065 |
T |
|
| Q |
223 |
aagttt |
228 |
Q |
| |
|
|||||| |
|
|
| T |
2851064 |
aagttt |
2851059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University