View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16642_high_22 (Length: 215)
Name: NF16642_high_22
Description: NF16642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16642_high_22 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 31975319 - 31975121
Alignment:
| Q |
19 |
tctcgtcaagaagcgatgagaagtttgtgcggagacaaataaatgaggttgttcataaaccattctaaatctattttttct--cattattatagaaactc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
31975319 |
tctcgtcaagaagcgatgagaagtttgtgcagagacaaataaatgaggttgctcataaaccattctaaatctattttttttatcattattatagaaactc |
31975220 |
T |
 |
| Q |
117 |
taatacgaagtatatgctgagacaaacaaatgagattgtttataatttatccaagacggttatatttaccgctagttttcagatgttggttgagatact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31975219 |
taatacgaagtatatgctgagacaaacaaatgagattgtttataatttatccaagacggccacatttaccgctagttttcagatgttggttgagatact |
31975121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University