View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16642_high_6 (Length: 440)
Name: NF16642_high_6
Description: NF16642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16642_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 39093128 - 39092904
Alignment:
| Q |
13 |
cagagttgcataaagtattaaggtcgtgagaatcttttgttgttttattgttgctttaggttctcagtcttaggtgtgcttcaagttcccatcggttttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39093128 |
cagagttgcataaagtattaaggtcgtgagaatcttttgttgttttcttgttgctttaggttctcagtcttaggtgtgcttcaagttcccatcggttttt |
39093029 |
T |
|
| Q |
113 |
cttggtttgtcttggaggcatttaacacgtattctattaagagttttatttaagtctctttactgttgttttatgtgtctacaaggggaattattcttca |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39093028 |
cttggtttgtcttggaggcatttaacatgtattctattaagagttttatttaagtctctttattgttgttttaggtgtctacaaggggaattattcttca |
39092929 |
T |
|
| Q |
213 |
caaactttgattttgccctgtattt |
237 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
39092928 |
caaactttgattttggcctgtattt |
39092904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 236 - 424
Target Start/End: Complemental strand, 39092851 - 39092664
Alignment:
| Q |
236 |
ttctcagtcttaggtgtgctttaagttatcatatcaaaacccatgtgtgtgttacaaagaagttgttttgcttttatagttttttaattgaaacaacata |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39092851 |
ttctcagtcttaggtgtgctttaagttatcatatcaaaacccatgtgtgagttacaaagaagttgttttgcttttatagttttttaattgaaacaacata |
39092752 |
T |
|
| Q |
336 |
agatattatttctgatacatgagatgcatgagtgtagtactctagtaaataatattcgagcaatcttgacccaataagagagagaatat |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39092751 |
agatattatttctgatacatgagatgcatgagtgtagtactctagtaaataatattcgagcaatcttgacccaa-aagagagagaatat |
39092664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University