View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16642_low_14 (Length: 321)
Name: NF16642_low_14
Description: NF16642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16642_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 20 - 317
Target Start/End: Complemental strand, 43537327 - 43537021
Alignment:
| Q |
20 |
ggtggcatggaggatggaaaaagtggattatggagaacgaaatcggaacaactagagtcagtgat------------gtccacaccgggatcaagtgagt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
43537327 |
ggtggcatggaggatggaaaaagtggattatggagaacgaaatcggaacaactagagtcagtggtagaagatttgacgtccacaccgggatcaagtgagt |
43537228 |
T |
 |
| Q |
108 |
cggtcggagtggcggacggtggtagtgggagtcttacaagaaaatcaaggagggcatcccccggtggaagaaatacacacataaggaaggcgaggagtgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537227 |
cggtcggagtggcggacggtggtagtgggagtcttactagaaaatcaaggagggcatcccccggtggaagaaatacacacataaggaaggcgaggagtgt |
43537128 |
T |
 |
| Q |
208 |
ccagacttctttgaaggttgatttggatcatgaggttaatagtggtgctgctcttagtagagcttcaagtttgggactctcattttcctttactggattc |
307 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537127 |
ccagacttctttgaaggttgatttgg---atgaggttaatagtggtgctgctcttagtagagcttcaagtttgggactctcattttcctttactggattc |
43537031 |
T |
 |
| Q |
308 |
tctgctcctc |
317 |
Q |
| |
|
|||| ||||| |
|
|
| T |
43537030 |
tctgttcctc |
43537021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University