View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16642_low_20 (Length: 295)
Name: NF16642_low_20
Description: NF16642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16642_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 213 - 277
Target Start/End: Complemental strand, 5524006 - 5523942
Alignment:
| Q |
213 |
gttgtagtgagtgggagattcattttatttggaattggaatctacgggaagaacactgatttcgt |
277 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5524006 |
gttgtagtgagtgggagattcatttcatttggaattggaatctacgggaagaacactgatttcgt |
5523942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University