View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16642_low_20 (Length: 295)

Name: NF16642_low_20
Description: NF16642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16642_low_20
NF16642_low_20
[»] chr7 (1 HSPs)
chr7 (213-277)||(5523942-5524006)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 213 - 277
Target Start/End: Complemental strand, 5524006 - 5523942
Alignment:
213 gttgtagtgagtgggagattcattttatttggaattggaatctacgggaagaacactgatttcgt 277  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
5524006 gttgtagtgagtgggagattcatttcatttggaattggaatctacgggaagaacactgatttcgt 5523942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University