View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16642_low_26 (Length: 253)
Name: NF16642_low_26
Description: NF16642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16642_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 21 - 242
Target Start/End: Original strand, 39015919 - 39016140
Alignment:
| Q |
21 |
caagattttttgccacttcttgagcttgtcttgcggcccatcgatcaatgatctttgagtgccttggactcaccaatgcagacaaagaagaatcattttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39015919 |
caagattttttgccacttcttgagcttgtcttgcggcccatcgatcaatgatctttgagtgccttggactcaccaatgcagacaaagaagaatcattttt |
39016018 |
T |
|
| Q |
121 |
gtctccaaatacattaggaaattttttgttgaaatttgggcttccaggtttgnnnnnnnnagcaacacttgaaacccatgttggtgttgaatcaaaggaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39016019 |
gtctccaaatacattaggaaattttttgttgaaatttaggcttccaggtttgttttttttagcaacacttgaaacccatgttggtgttgaatcaaaggaa |
39016118 |
T |
|
| Q |
221 |
gctatttcaacctgtgatgatg |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39016119 |
gctatttcaacctgtgatgatg |
39016140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University