View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16643_low_6 (Length: 266)
Name: NF16643_low_6
Description: NF16643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16643_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 56 - 250
Target Start/End: Original strand, 30788562 - 30788756
Alignment:
| Q |
56 |
gctagataaaaagttagattataatagattatagtattactcatttttgtgatagtgagtaatccaatcannnnnnnnagggagtaatccaatcaatctt |
155 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30788562 |
gctagataaaaaattagattatagtagattatagtattactcatttttatgatagagagtaatccaatcattttttttagggagtaatccaatcaatctt |
30788661 |
T |
|
| Q |
156 |
ggtttggcaaaataataagaaaaatcaaaattagatttatagcaaatatgatgatatgaactttttattatttgcacaactttttatacactagt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30788662 |
ggtttggcaaaataataagaaaaatcaaaattagatttatcgcaaatatgatgatatgaactttttattatttgcacaactttttatacactagt |
30788756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 156 - 234
Target Start/End: Complemental strand, 5163445 - 5163370
Alignment:
| Q |
156 |
ggtttggcaaaataataagaaaaatcaaaattagatttatagcaaatatgatgatatgaactttttattatttgcacaa |
234 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||| || | || |||||||||||| ||||||||||||||||| |
|
|
| T |
5163445 |
ggtttggcaaaataataagaaaagtaaaaattagattaattgtaa--ttgatgatatgaa-attttattatttgcacaa |
5163370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University