View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16644_low_2 (Length: 295)
Name: NF16644_low_2
Description: NF16644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16644_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 283
Target Start/End: Complemental strand, 24508319 - 24508055
Alignment:
| Q |
19 |
cccccgtgttgctgcgatatgtaatggagttttgacaaactcattcgaatctataatctctaaaatcgatgaattaacttggattactccatagaggagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24508319 |
cccccgtgttgctgcgatatgtaatggagttttgacaaactcattcgaatctataatctctaaaatcgatgaattaacttggattactccatagaggagg |
24508220 |
T |
 |
| Q |
119 |
cctatatcacctgcttcagctgcaacattcagttcatgatgaagaattggaattgggttcattttttaagatgcaactcttcgctgtgaaaaatctacct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24508219 |
cctatatcacctgcttcagctgcaacattcagttcatgatgaagaattggaattgggttcattttttaagctgcaactcttcgctgtgaaaaatctacct |
24508120 |
T |
 |
| Q |
219 |
gctactatattaatagtgcta--ataaataagcatctattgctctctttcttcccacattatattct |
283 |
Q |
| |
|
||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24508119 |
gctac--tatcaatagtgctaatataaataagcatctattgctctctttcttcccacattatattct |
24508055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 152
Target Start/End: Original strand, 17294234 - 17294354
Alignment:
| Q |
32 |
gcgatatgtaatggagttttgacaaactcattcgaatctataatctctaaaatcgatgaattaacttggattactccatagaggaggcctatatcacctg |
131 |
Q |
| |
|
|||||||| || ||||||| ||||||| |||||||||||||||||||| ||| ||||||| || ||| |||||| |||| |||| | |||||| ||| | |
|
|
| T |
17294234 |
gcgatatgcaaaggagtttcaacaaactgattcgaatctataatctctagaatggatgaatcaatttgaattactgcataaaggatgtctatattacccg |
17294333 |
T |
 |
| Q |
132 |
cttcagctgcaacattcagtt |
152 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
17294334 |
cttcagctgcaactttcagtt |
17294354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University