View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16645_high_10 (Length: 320)
Name: NF16645_high_10
Description: NF16645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16645_high_10 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 17 - 320
Target Start/End: Complemental strand, 155620 - 155317
Alignment:
| Q |
17 |
cacaactagcaaatgcctgagtccaagctcccgaaacagaagagcagcttttgcaagagacattgtttcaacaacagtatatggagaagtatttgtgatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
155620 |
cacaactagcaaatgcctgagtccaagctcccgaaacagaagagcagcttttgcaagagacattgtttcaacaacagtatatggagaagtatttgtgatt |
155521 |
T |
|
| Q |
117 |
ggatgaagatcaacatacatttccatctcctcttgtgaaatgtccaaatcctccacccttatccctcttcccaaacctggttttgcaaaatcccttgcct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
155520 |
ggatgaagatcaacatacatttccatctcctcttgtgaaatgtccaaatcctccacccttatccctcttcccaaacctggttttgcaaaatcccttgcct |
155421 |
T |
|
| Q |
217 |
taaccttgttcactatagtagaccctgtcatcaccctctccctagtgaacaatgtcttgtgcttgagaagcaccaaaagatgagacctcaacaccaaccc |
316 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
155420 |
taaccttgttcacaatagtagaccctgtcatcaccctctccctagtgaacaatgtcttgtgcttgagaagcacccaaagatgagacctcaacaccaaccc |
155321 |
T |
|
| Q |
317 |
acac |
320 |
Q |
| |
|
|||| |
|
|
| T |
155320 |
acac |
155317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 54 - 141
Target Start/End: Original strand, 24328780 - 24328867
Alignment:
| Q |
54 |
agaagagcagcttttgcaagagacattgtttcaacaacagtatatggagaagtatttgtgattggatgaagatcaacatacatttcca |
141 |
Q |
| |
|
|||| ||| ||||| ||||| ||||| || ||||| ||||| || || || ||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
24328780 |
agaatagcggctttagcaagtgacatagtctcaactacagtgtacggcgatgtattagttattggatgaagatcaacatacatatcca |
24328867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University