View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16645_high_15 (Length: 259)
Name: NF16645_high_15
Description: NF16645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16645_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 32 - 243
Target Start/End: Complemental strand, 56148342 - 56148136
Alignment:
| Q |
32 |
gttttcccacgacgagagggtctttaatttgtattgtttgtgtgtcaaattgcctaacatcaggtattgtgtgaaactttggatatcaaannnnnnngac |
131 |
Q |
| |
|
||||||||| |||||||||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
56148342 |
gttttcccatgacgagagggccttt----tgtattgtttgtgt--caaattgcctaacatcaggtattgtgtgaaactttggatatcaaaaatttttgac |
56148249 |
T |
 |
| Q |
132 |
tatatctttctttccaacatt-aaaatgtctaggattaaaatgttttgatgaatattcaatgtgatatatatcataatgttgaaaattacaaaatcattt |
230 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56148248 |
tatatctttctttccaacatttaaaatgtctaggattaaaatgttttgatgaatattcaatgtgatatatatcataatgttgaaaattacaaaatcattt |
56148149 |
T |
 |
| Q |
231 |
cgtatgaaacaat |
243 |
Q |
| |
|
||||||||||||| |
|
|
| T |
56148148 |
cgtatgaaacaat |
56148136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University