View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16645_high_7 (Length: 324)
Name: NF16645_high_7
Description: NF16645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16645_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 306
Target Start/End: Original strand, 19901042 - 19901328
Alignment:
| Q |
19 |
ttatcagttaccttgggtgatgtttcaaccaaggccctttgttcatgcacatctgcttgtacatgttgttcttcatttgtcgcataaggctcaggaatag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19901042 |
ttatcagttaccttgggtgatgtttcaaccaaggccctttgttcatgcacatctgcttgtacatgttgttcttcatttgtcgcataaggcccaggaatag |
19901141 |
T |
|
| Q |
119 |
aatcagaatgtgtaggttgttcgtttgcaatgatttttacctcacatgattcagcttgtaccgtgccatgttctgtaggtgcatattgtgaatacctatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19901142 |
aatcagaatgtgtaggttgttcgtttgcaatgatttttacctcacatgattcagcttgtaccgtgccatgttctgtaggtgcatattgtg-atacctatt |
19901240 |
T |
|
| Q |
219 |
gctgaacgataggaatgtcaacattcagtgtctcgaatgccttagatgagccgatgcttaaaggattctcttttgtcagccaaccttg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||| | |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19901241 |
gctgaacgataggaatgtcaacattcagtctctcaaatgcatcagatgagccgatgcttgaaggattctcttttgtcagccaaccttg |
19901328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University