View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16645_low_10 (Length: 333)
Name: NF16645_low_10
Description: NF16645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16645_low_10 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 154 - 333
Target Start/End: Original strand, 44415237 - 44415406
Alignment:
| Q |
154 |
ggactgttttttagccgagtttctaacttctaactagcactagaaaaacatattcgtgttcatattcaatattcaacggatagatccacttgggattaca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44415237 |
ggactgttttttagccgagtttctaacttctaactagcactagaaaaacatattcgtgttcatattcaatattcaacggatagatccact---------- |
44415326 |
T |
 |
| Q |
254 |
ataaagtcaaattactcttaagtcaaataaataataaagtagggaggaaaaacaatggacacacaaatatatgaattttc |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44415327 |
ataaagtcaaattactcttaagtcaaataaataataaagtagggaggaaaaacaatggacacacaaatatatgaattttc |
44415406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 4 - 90
Target Start/End: Original strand, 44415087 - 44415173
Alignment:
| Q |
4 |
tacatgtgatgttggttggttcatagaagtattttgaagctttatgttatattaattagtgtggtacacacggttaggtacaatgaa |
90 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44415087 |
tacatgtgatgttggttggttcatcgaagtattttgaagctttatgttatattaattagtgtggtacacacggttaggtacaatgaa |
44415173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University