View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16645_low_15 (Length: 307)
Name: NF16645_low_15
Description: NF16645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16645_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 17 - 296
Target Start/End: Original strand, 40687263 - 40687544
Alignment:
| Q |
17 |
actcatcacttattcattaaaatattccataaaactagaacaatcattaggttcattgatgagaacttgaatttaaggtatagctagtaacaaacaagat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40687263 |
actcatcacttattcattaaaatattccataaaactagaacaatcattaggttcattgatgagaacttgaatttaaggtatagctagtaacaaacaagat |
40687362 |
T |
 |
| Q |
117 |
taattgtgggcgggcataaattctagaattgaacatgtcacacattatgtgtgtgtggtctagagcacaaagt--agagagtgaggggatttgaagaaag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40687363 |
taattgtgggcgggcataaattctagaattgaacatgtcacacattatgtgtgtgtggtctagagcacaaagtagagagagtgaggggatttgaagaaag |
40687462 |
T |
 |
| Q |
215 |
cttcatgtttctccacatctctttattttgagtaaactatgttggtaaaaatgtaatcattgttggcctttcctttgccttt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40687463 |
cttcatgtttctccacatctctttattttgagtaaactatgttggtaaaaatgtaatcattgttggcctttcctttgtcttt |
40687544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University