View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16645_low_16 (Length: 294)
Name: NF16645_low_16
Description: NF16645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16645_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 276
Target Start/End: Original strand, 27300147 - 27300410
Alignment:
| Q |
13 |
aaaatgtaaaccaatttaccttagcactaaccgagacaaggacattatcatccacactggaaacattaaggtgtagaatattaaagccaagattttgaat |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
27300147 |
aaaatgtaaaccaatttaccttggcactaaccgagacaagaacattatcatccatactggaaacattaaggtgtagaatgttgaagccaagattttgaat |
27300246 |
T |
|
| Q |
113 |
cccaacaaccatcttcataacctgtccttgtcgttttttcaacattatctttatattcgcttgactatcaaccaaagtcacttctatatctgccatggca |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27300247 |
cccagcaaccatcttcataacctgtccttgtcgttttttcaacattatctttatattcgcatgactatcaaccaaagtcacttctatatctcccatggca |
27300346 |
T |
|
| Q |
213 |
cgtgactgattatggttggtagggtagcacgtgatgttctgatgtgcacccatagagtattgag |
276 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27300347 |
cgtgactgattatgtttggtagggtagcacgtgatgttctgacgtgcatccatagagtattgag |
27300410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University