View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16645_low_19 (Length: 269)
Name: NF16645_low_19
Description: NF16645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16645_low_19 |
 | |
|
| [»] scaffold0366 (2 HSPs) |
| | |
|
| [»] scaffold0459 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0366 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 9059 - 8959
Alignment:
| Q |
1 |
aaaacacctttcaagggtattgtagatgattttaggggaagagcagtacactataaagatgattggatttctggtctcacttctggaaccgggtaagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9059 |
aaaacacctttcaagggtattgtagatgattttaggggaagagcagtacactataaagatgattggatttctggtctcacttctggaaccgggtaagctt |
8960 |
T |
|
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
8959 |
c |
8959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 8889 - 8807
Alignment:
| Q |
171 |
ttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatgcagttgatac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8889 |
ttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatgcagttgatac |
8807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 9135 - 9035
Alignment:
| Q |
1 |
aaaacacctttcaagggtattgtagatgattttaggggaagagcagtacactataaagatgattggatttctggtctcacttctggaaccgggtaagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9135 |
aaaacacctttcaagggtattgtagatgattttacgggaagagcagtacactataaagatgattggatttctggtctcacttctggaaccgggtaagctt |
9036 |
T |
|
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
9035 |
c |
9035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 171 - 253
Target Start/End: Complemental strand, 8965 - 8883
Alignment:
| Q |
171 |
ttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatgcagttgatac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8965 |
ttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatgcagttgatac |
8883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 12319281 - 12319181
Alignment:
| Q |
1 |
aaaacacctttcaagggtattgtagatgattttaggggaagagcagtacactataaagatgattggatttctggtctcacttctggaaccgggtaagctt |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | || |||||||||||||||| |
|
|
| T |
12319281 |
aaaaaacctttcaagggtattgtagatgattttaggggaagagcagtacactataaagatgattggatttcaggtctcgcctcaggaaccgggtaagctt |
12319182 |
T |
|
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
12319181 |
c |
12319181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University