View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16645_low_23 (Length: 250)
Name: NF16645_low_23
Description: NF16645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16645_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 126 - 242
Target Start/End: Complemental strand, 13558485 - 13558369
Alignment:
| Q |
126 |
aggaaaaggataagcttgttggagaggttatccgatacatgctgttcaagacccatcaaaactcagggtgcccaattaagagagaggaactcactcagct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13558485 |
aggaaaaggataagcttgttggagaggttatccgatacatgctgttcaagacccatcaaaactcagggtgcccaattaagagagacgaactcactcagct |
13558386 |
T |
 |
| Q |
226 |
tattacgaagaattatc |
242 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13558385 |
tattacgaagaattatc |
13558369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 13558612 - 13558544
Alignment:
| Q |
1 |
aacattgaagatttctcccaattcggaatttctaaagaggtgtgttcaatcttcctttgaaaaagtcac |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13558612 |
aacattgaagatttctcccaattcggaatttctaaagaggtgtgttcaatcttcctttgaaaaagtcac |
13558544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University