View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16645_low_5 (Length: 468)

Name: NF16645_low_5
Description: NF16645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16645_low_5
NF16645_low_5
[»] chr5 (1 HSPs)
chr5 (14-147)||(25615311-25615444)
[»] chr6 (1 HSPs)
chr6 (147-290)||(24992809-24992972)


Alignment Details
Target: chr5 (Bit Score: 113; Significance: 5e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 14 - 147
Target Start/End: Complemental strand, 25615444 - 25615311
Alignment:
14 aaaattacaaattcaaggacatcgaacatagaaagaatttatgtaatacattgagaacaaaaatttcaattcagttgacnnnnnnngattctatatcgaa 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||    
25615444 aaaattacaaattcaaggacatcgaacatagaaagaatttatgtaatacattgagaacaaaaatttcaattcagttgacaaaaaaagattctatatcgaa 25615345  T
114 gctaaaacatattaagcaatgtatctcattgaaa 147  Q
    ||||||||||||||||||||||||||||||||||    
25615344 gctaaaacatattaagcaatgtatctcattgaaa 25615311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 71; Significance: 6e-32; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 147 - 290
Target Start/End: Complemental strand, 24992972 - 24992809
Alignment:
147 atcagaggtgacctcttcaactgtcttttctcaaagtcattcaaagtttccgggctttgatctccgcttgagcttctga--------------------t 226  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||||||||||||||||||||                    |    
24992972 atcagaggtgacctcttcaactgtcttttctctaagtcattcaaagttttcgggctatgatctccgcttgagcttctgattaattgaatatagagcttct 24992873  T
227 gattatctgtaactataaatagggagagaaggcaccacaatcaacgaacacaacaaaattgagt 290  Q
    ||||||||||||| | ||||||||||||||| ||||||||||||||||||||| ||||||||||    
24992872 gattatctgtaaccacaaatagggagagaagacaccacaatcaacgaacacaataaaattgagt 24992809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University