View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16647_high_18 (Length: 249)
Name: NF16647_high_18
Description: NF16647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16647_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 8e-39; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 49 - 142
Target Start/End: Original strand, 34982531 - 34982624
Alignment:
| Q |
49 |
tgaaattttaatcaacatcattttggggtgatgcttggttagatagtggtgttttgcggtctagattcaactttcaggtgaggcacttaagctt |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34982531 |
tgaaattttaatcaacatcattttggtgtgatgtttggttagatagtggtgttttgcggtctagattcaattttcaggtgaggcacttaagctt |
34982624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 153 - 239
Target Start/End: Original strand, 34982723 - 34982811
Alignment:
| Q |
153 |
caggttaatagaatagacaaatgaatctggcaacata--accccaatgagggatactttgtaaaagggcttatcgtattctcatgccta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34982723 |
caggttaatagaatagacaaatgaatctggcaacatataaccccaatgaaggatactttgtaaaagggcttatcgtattctcatgccta |
34982811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 54
Target Start/End: Original strand, 34981952 - 34981990
Alignment:
| Q |
16 |
gtatatatgtctagaatgataacagaagttatctgaaat |
54 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34981952 |
gtatatatgtgtagaatgataacagaagttatctgaaat |
34981990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University