View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16647_high_19 (Length: 246)
Name: NF16647_high_19
Description: NF16647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16647_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 35357850 - 35358060
Alignment:
| Q |
19 |
gggcacaacagttttggttcgttttgggaggtcatataaggtaaacatctctatgcctcatctttggtcatgaatgtagaatctaaaacttgcatgttca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35357850 |
gggcacaacagttttggttcgttttgggaggtcatatgaggtaaacatctctatgcctcgtctttggtcatgaatgtagaatttaaaacttgcatgttca |
35357949 |
T |
 |
| Q |
119 |
ttttgcacatgggaatgtacaattcannnnnnnnnnnnnnnnnnnnattgttgttggtggtaag-aactaagtatagtttttatcaactcatagcaatta |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35357950 |
ttttgcacatgggaatgtacaattcattttatttttcttttcttttattgttgttggtggtaagaaactaagtatagtttttatcaactcatagcaatta |
35358049 |
T |
 |
| Q |
218 |
ccactcataat |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
35358050 |
ccactcataat |
35358060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University