View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16647_low_19 (Length: 309)
Name: NF16647_low_19
Description: NF16647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16647_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 8 - 290
Target Start/End: Complemental strand, 37937054 - 37936772
Alignment:
| Q |
8 |
gacatcatcaccggcactggcattggtgcaatactcgctgcaatgatcacagctgatgatggatttggtagacctctctatactgctagagatgctgtga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37937054 |
gacatcatcaccggcactggcattggtgcaatactcgctgcaatgatcacagctgatgatggatttggtagacctctctatactgctagagatgctgtga |
37936955 |
T |
 |
| Q |
108 |
atttcattgctgacaggaatcatgaattctataaaatgaaatccgtcggtgttttccgccggcgccgtagattctcaacgaagagcattgaaaatttgtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936954 |
atttcattgctgacaggaatcatgaattctataaaatgaaatccgtcggtgttttccgccggcgccgtagattctcaacgaagagcattgaaaatttgtt |
37936855 |
T |
 |
| Q |
208 |
gaagcgagtttttcaaggaaaagaaagcgaaggtaaatctttgacgttgaaagatacgattaagcctttgcttattccttgct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936854 |
gaagcgagtttttcaaggaaaagaaagcgaaggtaaatctttgacgttgaaagatacgattaagcctttgcttattccttgct |
37936772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University