View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16647_low_21 (Length: 258)
Name: NF16647_low_21
Description: NF16647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16647_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 41667651 - 41667463
Alignment:
| Q |
1 |
tattcatccatccacaacactaatcaattctttatttaaatcgtgagttgattgcttgacacccatttaaaatttctgatcttaatgtttgttcttattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41667651 |
tattcatccatccacaacactaatcaattctttatttaaatcgtgagttgattgcttgacacccatttaaaatttctgatcttaatgtttgttcttattt |
41667552 |
T |
 |
| Q |
101 |
taggtcacctaaggaattaagggcttaatcaagatcaaaggttaactagcctaaggaattacaattttgaataggactagaccattcag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41667551 |
taggtcacctaaggaattaagggcttaatcaagatcaaaggttaacttgcctaaggaattacaattttgaataggactagaccattcag |
41667463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 97
Target Start/End: Complemental strand, 41658461 - 41658419
Alignment:
| Q |
55 |
cttgacacccatttaaaatttctgatcttaatgtttgttctta |
97 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
41658461 |
cttgacacacatttaaaatttctgaccttaatgcttgttctta |
41658419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University