View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16647_low_3 (Length: 619)
Name: NF16647_low_3
Description: NF16647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16647_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 16 - 380
Target Start/End: Complemental strand, 3305762 - 3305400
Alignment:
| Q |
16 |
atcattgcttggtaaaacaattcatgcagcaccttgttcaatttccataatcctacttaaactacaaatggtacgtatcatagctagtaatttaattgct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305762 |
atcattgcttggtaaaacaattcatgcagcaccttgttcaatttccataatcctacttaaactacaaatggtacgtatcatagctagtaatttaattgct |
3305663 |
T |
|
| Q |
116 |
tatgctaaccgttgccacaatatattatatatgcagcatctataatgattctggatctgatcaaaatctttattaattatagtattcttcttatattatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3305662 |
tatgctaaccgttgccacaatatattatatatgcagcatctataatgattctggatctcatcaaaatcttt----attatagtattcttcttatattatt |
3305567 |
T |
|
| Q |
216 |
gatctatttgtcaaatgtgattgtggacttttaatgcagattcnnnnnnnnnnnnnnnctagtgcttctttaccactagaatgcatcagctattctttgc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3305566 |
gatctatttgtcaaatgtgattgtggacttttaatgcagattctttttgattttttttctagtgcttctttaccactagaatgcatcaactattctttgc |
3305467 |
T |
|
| Q |
316 |
acatttcttttggttactattgcaggtgttgtttttgcatttagttgtt--gccaagtttataaaac |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3305466 |
acatttcttttggttactattgcaggtgttgtttttgcatttagttgttgcgccaagtttataaaac |
3305400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 451 - 537
Target Start/End: Complemental strand, 3305364 - 3305278
Alignment:
| Q |
451 |
gttcgttcacgagattgtttctcctttttaaaattcagnnnnnnnatccttgctcaggttttggaccaataagtgttgactagccaa |
537 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
3305364 |
gttcgttcacgagattgtttctcctttttaaaattcagtttttttatccttgctcaggttttggacccagaagtgttgacttgccaa |
3305278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 558 - 605
Target Start/End: Complemental strand, 3305207 - 3305160
Alignment:
| Q |
558 |
aaaataacttcaatgttcccacttggtgatgttgattgatgctatatt |
605 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3305207 |
aaaataacttcaatgttcccacttggtgatgttgattgatgcaatatt |
3305160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University