View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16648_high_10 (Length: 229)
Name: NF16648_high_10
Description: NF16648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16648_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 37 - 213
Target Start/End: Complemental strand, 10530452 - 10530276
Alignment:
| Q |
37 |
tatattggttgtttaggttttctgtctagggtggacgtaggtgacaggttgattatcactcacaacagtcgattatactaaaatctaatgtttattagag |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10530452 |
tatattggttgtttaggttttctgtctagggtggacgtaggtgacaggtttattatcactcacaacagtcgattatactaaaatctaatgtttattagag |
10530353 |
T |
 |
| Q |
137 |
caatattttaatgattgtgagtaataattgaccatggaccacagttcgctctagaagccgacgttgtctatttgttc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
10530352 |
caatattttaatgattgtgagtaataatcgaccgtggaccacagtttgctctagaagccgacgctgtctatttgttc |
10530276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University