View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16648_high_2 (Length: 367)
Name: NF16648_high_2
Description: NF16648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16648_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 7 - 347
Target Start/End: Complemental strand, 44187508 - 44187168
Alignment:
| Q |
7 |
atgtctagagtcgtagagtgtataattttggaatacatccaactttgttcaactttctacttgcagcaaatgattttgatgaagaacgtagtagcaccaa |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44187508 |
atgtctagagtcgtagggtgtataattttggaatacatcccactttgttgaactttctacttgcagcaaatgattttgatgaagaacgtagtagcaccaa |
44187409 |
T |
|
| Q |
107 |
aaaagcaaagatgcttcatgtttaaacgcaattggatttggaacgtcacatctttctcgtattttatttacaagcctatgcagctatctatacattgctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44187408 |
aaaagcaaagatgcttcatgtttaaacgcaattggatttggaacgtcacatctttctcgtattttatttacaagcctatgcagctatctatacattgctt |
44187309 |
T |
|
| Q |
207 |
gggatttatatgccttgcccaattatgttaataatcagctcatagttgataccaagattttgtcatcgtgaaattggcctcaaaacgcttatgtgatgga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44187308 |
gggatttatatgccttgcccaattatgttaataatcagctcatagtttataccaaggttttttcatcgtgaaattggcctcaaaacacttatgtgatgga |
44187209 |
T |
|
| Q |
307 |
caaaagtattaacggcaaccaataattaaatataggatcag |
347 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
44187208 |
caaaagtatcaacggcaaccaataactaaatataggatcag |
44187168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University