View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16648_high_4 (Length: 323)
Name: NF16648_high_4
Description: NF16648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16648_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 26710979 - 26710882
Alignment:
| Q |
1 |
ttggttgattatgtatctcctttgttgattgttgttgtgtattacactc-tttattcttcttaaatgtattatgctattggttttctttgcaaatttt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26710979 |
ttggttgattatgtatctcctttgttgattgttgttgtgtattacactcttttatacttcttaaatgtattatgctattggttttctttgcaaatttt |
26710882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 202 - 313
Target Start/End: Complemental strand, 26710783 - 26710672
Alignment:
| Q |
202 |
ttagtggtatcagagtaggtctgtccattctaaccatgtgggtcatgtgttagtcttgcatctattgtgtttatgtacatccttgttaatattttgaatt |
301 |
Q |
| |
|
||||||||||||||| |||||||| ||||| | | |||||||||||||| |||||||||||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
26710783 |
ttagtggtatcagagcaggtctgttcattcagatcgtgtgggtcatgtgtcagtcttgcatctgttgtgtttgtgtacatccttcttaatattttgaatt |
26710684 |
T |
 |
| Q |
302 |
gttttccctttg |
313 |
Q |
| |
|
|||||||||||| |
|
|
| T |
26710683 |
gttttccctttg |
26710672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University