View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16648_high_9 (Length: 242)
Name: NF16648_high_9
Description: NF16648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16648_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 44187164 - 44186949
Alignment:
| Q |
1 |
ttggtgcggtaaaaaagcacacaggttggtgtgtaatatatcaaacaatactagtatatagatttaatctagcaccctatatgtaaaacaaatccacggt |
100 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44187164 |
ttggtgcggtaaaaaagcatacagtttggtgtgtaatatatcaaacaatactagtatatagatttaatctagcaccctatatgtaaaacaaatccacggt |
44187065 |
T |
 |
| Q |
101 |
caaagcaaaacaacaagataaaaataataggtttgattttataaatttagtgaatgttaacacatcctctaactctttacggtgcaaaagatgagcaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
44187064 |
caaagcaaaacaacaagataaaaataataggtttgatttt---aatttagtgaatgttaatacatc------ctctttacggtgcaaaagatgagcaaat |
44186974 |
T |
 |
| Q |
201 |
caatatagttaatacatgaatgata |
225 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
44186973 |
caataaagttaatacatgaatgata |
44186949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University