View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16648_low_13 (Length: 210)
Name: NF16648_low_13
Description: NF16648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16648_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 36117207 - 36117387
Alignment:
| Q |
13 |
caaaggaaattgagtctctggagcaagtgcaccattcagaaaaagaggtggattcccaaaaaagtttggaatcaagttcaagttttgtggaatggaacgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36117207 |
caaaggaaattgagtctctggagcaagtgcaccattcagaaagagaggtggattcccaaaaaagtttggaatcaagttcaagttttatggaatggaacgt |
36117306 |
T |
|
| Q |
113 |
gagagcaccattggagataatatacgaaggatatgaagatgaagaaaaattggatgattcaaatgaaaaagaagaaaactg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36117307 |
gagagcaccattggagataatatacgaaggatatgaagatgaagaaaaattggatgatccaaatgaaaaagaagaaaactg |
36117387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University