View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16648_low_9 (Length: 264)
Name: NF16648_low_9
Description: NF16648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16648_low_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 81 - 264
Target Start/End: Complemental strand, 48064698 - 48064499
Alignment:
| Q |
81 |
gagttaatgaacggttacttaccaactgcaatgtttgacggaaaatggatatataatggacggtgcataagttgaagggttgtttgtttg---------- |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48064698 |
gagttaatgaacggttacttaccaactgcaatgtttgacggaaaatggatatatagtggacggtgcataagttgaagggttgtttgtttgtttgtttgtt |
48064599 |
T |
 |
| Q |
171 |
------ataaatcatacaatatgaaggtcggtgcagcagagctatgcattttgttgttcaccacatcttgccttcttcacttttcatcagagctacaaca |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48064598 |
tgtttgataaatcatacaatatgaaggtcggtgcagcagagctatgcattttgttgttcaccacatcttgccttcttcacttttcatcagagctacaaca |
48064499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University