View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16649_high_4 (Length: 307)
Name: NF16649_high_4
Description: NF16649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16649_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 150 - 290
Target Start/End: Complemental strand, 46489370 - 46489230
Alignment:
| Q |
150 |
tcatgatatgatctgattttcctattatgtttagtaatcgtgatcagtctatttagtttaagttctcattattcaaaccctacttgccaaaccagatcct |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46489370 |
tcatgatatgatctgattttcctattatgtttagtaatcatgatcagtctatttagtttaagttctcattattcaaaccctacttgccaaaccagatcct |
46489271 |
T |
|
| Q |
250 |
ttttatgaatatgaatcctcatcatggtggaatgaaggagg |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46489270 |
ttttatgaatatgaatcctcatcatggtggaatgaaggagg |
46489230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 4 - 108
Target Start/End: Complemental strand, 46489515 - 46489402
Alignment:
| Q |
4 |
ataacataacaactattttataaatgaattgaacaaaactcaagacagcatgtacctgct---------ttcactcacatcattccaatcaaaaacactt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46489515 |
ataacataacaactattttataaatgaattgaacaaaactcaagacagcatgtacctgcttcatgttccttcactcacatcattccaatcaaaaacactt |
46489416 |
T |
|
| Q |
95 |
ccaaagatcataaa |
108 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46489415 |
ccaaagatcataaa |
46489402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University