View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16650_high_4 (Length: 287)
Name: NF16650_high_4
Description: NF16650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16650_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 39306083 - 39305814
Alignment:
| Q |
1 |
atatttatgagagagaaagtgacaatagtgttttttgttgtgataggcattgactaacggagtatacaagagttgtctccatagggtattggctaataag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39306083 |
atatttatgagagagaaagtgacaatagtgttttttgttgtgataggcattgactaatggagtatacaagagttgtctccatagggtattggctaatagg |
39305984 |
T |
 |
| Q |
101 |
gagaaggatagaaagactcttgctttctttttgtgtccaaaaggagacaaaattgtgagagcacctgaaaatatactgggaagacaagagccaatgaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39305983 |
gagaaggatagaaagactcttgctttctttttgtgtccaaaaggagacaaaattgtgagagcacctgaaaatatactgggaagacaagagccaacgaaat |
39305884 |
T |
 |
| Q |
201 |
atcctgatttcacttggaaacaatttttcgagtttacacaaaggaagcatagggctgatcccaacactct |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305883 |
atcctgatttcacttggaaacaatttttcgagtttacacaaaggaagcatagggctgatcccaacactct |
39305814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University