View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16651_high_12 (Length: 250)
Name: NF16651_high_12
Description: NF16651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16651_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 36524219 - 36523999
Alignment:
| Q |
17 |
atagaaaaagtttcgcaaatttactattctctaatttgtgcttaatcttttggcgggaacgtgtttcaagttggtaatgggaaatttcaatatcttctgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36524219 |
atagaaaaagtttcgcaaatttactattctctaatttgtgcttaatcttttggcgggaacgtgtttcaagtttgtaatgggaaatttcaatatcttctgg |
36524120 |
T |
|
| Q |
117 |
ttggtgatttggaattaagctcaccttcgagtgccggcaaatcaaagaatacaatgcacatgtgccacctaataatatccattaaaaaataaatacagtt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
36524119 |
ttggtgatttggaattaagctcaccttcgagtgccggcaaatcaaagaatacaatgcacatgtgccacctaataatatccattcaaaaataaataaagtt |
36524020 |
T |
|
| Q |
217 |
attcttctttgattgtgacct |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
36524019 |
attcttctttgattgtgacct |
36523999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University