View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16651_low_13 (Length: 250)

Name: NF16651_low_13
Description: NF16651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16651_low_13
NF16651_low_13
[»] chr8 (1 HSPs)
chr8 (17-237)||(36523999-36524219)


Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 36524219 - 36523999
Alignment:
17 atagaaaaagtttcgcaaatttactattctctaatttgtgcttaatcttttggcgggaacgtgtttcaagttggtaatgggaaatttcaatatcttctgg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
36524219 atagaaaaagtttcgcaaatttactattctctaatttgtgcttaatcttttggcgggaacgtgtttcaagtttgtaatgggaaatttcaatatcttctgg 36524120  T
117 ttggtgatttggaattaagctcaccttcgagtgccggcaaatcaaagaatacaatgcacatgtgccacctaataatatccattaaaaaataaatacagtt 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||    
36524119 ttggtgatttggaattaagctcaccttcgagtgccggcaaatcaaagaatacaatgcacatgtgccacctaataatatccattcaaaaataaataaagtt 36524020  T
217 attcttctttgattgtgacct 237  Q
    |||||||||||||||||||||    
36524019 attcttctttgattgtgacct 36523999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University