View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16652_high_23 (Length: 241)
Name: NF16652_high_23
Description: NF16652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16652_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 37217150 - 37217360
Alignment:
| Q |
16 |
cataaagttgaacttagattgcttggttacctactcaataggaaatatataatgtatgatagagatcatggaaaaagaaatttcaaagaccttgccttag |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217150 |
cataaagttgaacttagattgcttggtcacctactcaataggaaatatataatgtatgatagagatcatggaaaaagaaatttcaaagaccttgccttag |
37217249 |
T |
 |
| Q |
116 |
ttcaaactgtcattcaccttttgatttgcttagcttgtgctatatgatatatatagtacactttttatttggtgaatcaattacaatattcgacatttgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217250 |
ttcaaactgtcattcaccttttgattttcttagcttgtgctatatgatatatatagtacactttttatttggtgaatcaattacaatattcgacatttgt |
37217349 |
T |
 |
| Q |
216 |
tgccacctatg |
226 |
Q |
| |
|
|||||| |||| |
|
|
| T |
37217350 |
tgccacttatg |
37217360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University