View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16652_high_25 (Length: 231)
Name: NF16652_high_25
Description: NF16652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16652_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 47 - 212
Target Start/End: Complemental strand, 6725052 - 6724887
Alignment:
| Q |
47 |
ctaatgttgaaatatacaatgcagctctgcaaagtttgtactttatgtccgttcactggattcaaagtctcttatagtataagattgaattatatacgtt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6725052 |
ctaatgttgaaatatacaatgcagctctgcaaagtttgtactttatgtccgttcactggattcaaagtctcttatagtataagattgaattatatacgtt |
6724953 |
T |
 |
| Q |
147 |
caaaccatgaaaggatgaaactccatcagtaccataatcattccaacatttaacgtttatttgggt |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6724952 |
caaaccatgaaaggatgaaattccatcagtaccataatcattccaacatttaacgtttatttgggt |
6724887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 6725774 - 6725725
Alignment:
| Q |
1 |
atctccagaagttatagtcaaaaccatcttatcaaggtgtccctccctaa |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6725774 |
atctccagaagttatagtcaaaaccatcttatcaaggtgtccctccctaa |
6725725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University