View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16652_high_28 (Length: 207)
Name: NF16652_high_28
Description: NF16652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16652_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 8 - 189
Target Start/End: Original strand, 36287193 - 36287374
Alignment:
| Q |
8 |
agtgagatgaactacggttaaaaattccacctgaatattttcattgcnnnnnnngggcgagtgagaaaaaatcctggatacagctcaattcacacgtgga |
107 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36287193 |
agtgggatgaactacagttaaaaattccacctgaatattttcagtgcaaaaaaagggcgagtgagaaaaattcctggatacagctcaattcacacgtgga |
36287292 |
T |
 |
| Q |
108 |
tggtgaaattcacgagttcctcatgtggccatggatgtggggtatgatcaaaatgttctatctaagttggaggaggttgtgt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36287293 |
tggtgaaattcacgagttcctcatgtggccatggatgtggggtatgatcaaaatgttctatctaagttggaggaggttgtgt |
36287374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University