View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16652_low_19 (Length: 302)
Name: NF16652_low_19
Description: NF16652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16652_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 3 - 286
Target Start/End: Original strand, 11011921 - 11012204
Alignment:
| Q |
3 |
aaaagaaattttcaaagagtttaggagaagagcgtacataaggtcggtccaagagttcatttaggtggtagttgaaatgatgttaatgtacgatgcttga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
11011921 |
aaaagaaattttcaaagagtttaggagaagagcgtacataaggtcggtccaagagttcatttaggtggtagttaaaatgatgttaatgtccgatgcttga |
11012020 |
T |
|
| Q |
103 |
gaacaaatagtctttaatggagtcaatggggcattaaatgcgtggagagttcacggacactatttcttgattgttgagatgtgtcctatgcaggcatagt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11012021 |
gaacaaatagtctttaatggagtcaatggggcattaaatgcgtggagagttcacggacactatttcttgattgtcgagatgtgtcctatgcaggcatagt |
11012120 |
T |
|
| Q |
203 |
gaacagtgacgctcttaggcttactctagtgtaattacagtgtcgagccaaaattaggattattagattagctcagttggtatg |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11012121 |
gaacagtgacgctcttaggcttactctagtgtaattacagtgtcgagccaaaattaggattattagattagctcagttggtatg |
11012204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University