View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16652_low_25 (Length: 232)
Name: NF16652_low_25
Description: NF16652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16652_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 29551362 - 29551555
Alignment:
| Q |
19 |
gttgttccattctcctcaatttgcattgcatagtgagctccacacaaagtatagctagctagaaaaggaaaagctaggtatatatagagcttctgtgttt |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29551362 |
gttgttccattctcctcaatttgc-----atagtgagctccacacaaagtatagctagctacaaaagggaaagctaggtatatatagagcttctgtgttt |
29551456 |
T |
 |
| Q |
119 |
gtgtggaggcagagacaattcaaagaagtgattatggggatgatgtgtattagaatcatattgctactagctgcttattgcttgcttcctctatctgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29551457 |
gtgtggaggcagagacaattcaaataagtgattatggggattatgtgtattagaatcatatttctactagctgcttattgcttgcttcctctatctgtg |
29551555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University