View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16654_high_22 (Length: 278)
Name: NF16654_high_22
Description: NF16654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16654_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 263
Target Start/End: Complemental strand, 40274925 - 40274679
Alignment:
| Q |
14 |
gaaaatttctgaatccaccagtttgtgacacttattaatttgacacaaacatataatattatataacgatttacgcaagagatagaggagaattgagtga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40274925 |
gaaaatttctgaatccaccagtttgtgacacttattaatttcacacaaacatataatatg---taacgatttacgcaagagatagaggagaattgagtga |
40274829 |
T |
|
| Q |
114 |
aggaaattgaactcacacatgttgcagcatgcagaaatgatgtactgtatgagggaaagaaaattgtctcttaattagcttcaaaccaaagccaacaaca |
213 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40274828 |
acgaaattgaactcacacatgttgcagcatgcagaaatgatgtactgtatgagggaaagaaaattgtctcttaattagcttcaaaccaaagccaacaaca |
40274729 |
T |
|
| Q |
214 |
aagggttggaggctcggagcagatagatagatagacggggaagtatatat |
263 |
Q |
| |
|
||||||| ||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
40274728 |
aagggttagagcctcagagcagatagatagatagatggggaagtatatat |
40274679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 157
Target Start/End: Original strand, 40599147 - 40599191
Alignment:
| Q |
113 |
aaggaaattgaactcacacatgttgcagcatgcagaaatgatgta |
157 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
40599147 |
aaggaattggaactcacacatgttgcagcatgcataaaggatgta |
40599191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University