View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16654_high_22 (Length: 278)

Name: NF16654_high_22
Description: NF16654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16654_high_22
NF16654_high_22
[»] chr5 (2 HSPs)
chr5 (14-263)||(40274679-40274925)
chr5 (113-157)||(40599147-40599191)


Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 263
Target Start/End: Complemental strand, 40274925 - 40274679
Alignment:
14 gaaaatttctgaatccaccagtttgtgacacttattaatttgacacaaacatataatattatataacgatttacgcaagagatagaggagaattgagtga 113  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    |||||||||||||||||||||||||||||||||||||    
40274925 gaaaatttctgaatccaccagtttgtgacacttattaatttcacacaaacatataatatg---taacgatttacgcaagagatagaggagaattgagtga 40274829  T
114 aggaaattgaactcacacatgttgcagcatgcagaaatgatgtactgtatgagggaaagaaaattgtctcttaattagcttcaaaccaaagccaacaaca 213  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40274828 acgaaattgaactcacacatgttgcagcatgcagaaatgatgtactgtatgagggaaagaaaattgtctcttaattagcttcaaaccaaagccaacaaca 40274729  T
214 aagggttggaggctcggagcagatagatagatagacggggaagtatatat 263  Q
    ||||||| ||| ||| ||||||||||||||||||| ||||||||||||||    
40274728 aagggttagagcctcagagcagatagatagatagatggggaagtatatat 40274679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 113 - 157
Target Start/End: Original strand, 40599147 - 40599191
Alignment:
113 aaggaaattgaactcacacatgttgcagcatgcagaaatgatgta 157  Q
    |||||| | ||||||||||||||||||||||||| ||| ||||||    
40599147 aaggaattggaactcacacatgttgcagcatgcataaaggatgta 40599191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University