View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16654_high_32 (Length: 224)
Name: NF16654_high_32
Description: NF16654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16654_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 27764484 - 27764292
Alignment:
| Q |
16 |
caaaggttgtatggtagtgacattgagatgtaggatactaaggaagagtgtttgaaaaccagccactaatttagttagttgtcctggtcttgtcctagtg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27764484 |
caaaggttgtatggtagtgacattgagatgtaggatactaaggaagagtctttgaaaaccagccactaatttagttagttgtcctggtcttgtcctagtg |
27764385 |
T |
 |
| Q |
116 |
agaattctaaggtttgcatgagtctcgatcaatgtaacctcgatatcagctatggcagctttggtcttggatgtgtatttgttaggtgtttgg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27764384 |
agaattctaaggtttgcatgagtctcgatcaatgtaacctcgatatcagctatggcagctttggtcttggatgtgtatttgttaggtgtttgg |
27764292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University