View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16654_high_34 (Length: 209)
Name: NF16654_high_34
Description: NF16654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16654_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 34171253 - 34171072
Alignment:
| Q |
19 |
caaaccgatcacacgatcaaatgttagataaaatctatcgcttttaaaaat----tattaatcaaaaagaaaagttaacaagtactgaatttaaagttag |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34171253 |
caaaccgatcacacgatcaaatgtcagataaaatctatcgcttttaaaaataaattattaatcaaaaagaaaagttaacaagtactgaatttaaagttag |
34171154 |
T |
 |
| Q |
115 |
agagttgtagcactttcagttgttgatgttaggtgctgctggtgattttgggcttggcagttccttcgccgcggtctctgct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34171153 |
agagttgtagcactttcagttgttgatgttaggtgctgctggtgattttgggcttggcagttccttcgccgcagtctctgct |
34171072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 71 - 123
Target Start/End: Complemental strand, 34141896 - 34141845
Alignment:
| Q |
71 |
attaatcaaaaagaaaagttaacaagtactgaatttaaagttagagagttgta |
123 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
34141896 |
attaatcaaaaagaaaagttaacaagttctgaa-ttaaagttcgagagttgta |
34141845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University