View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16654_low_26 (Length: 253)
Name: NF16654_low_26
Description: NF16654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16654_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 36275723 - 36275489
Alignment:
| Q |
1 |
aagactgatgaagtagaacaaaacggtgaagaagaaacaaccggagcaggagaacccggatccgaattggaaacattatcttgctgttgaagaagatgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36275723 |
aagactgatgaagtagaacaaaacggtgaagaagaaacaaccggagcaggagaacccggatccgaattcgaaacattatcttgctgttgaagaagatgtc |
36275624 |
T |
 |
| Q |
101 |
gttgttgttctttaggtcgtgattcgggtagttcagagttattatccaacccgaatagataatcgggtacttcagaaaccatagaagaagcttctgatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275623 |
gttgttgttctttaggtcgtgattcgggtagttcagagttattatccaaaccgaatagataatcgggtacttcagaaaccatagaagaagcttctgatct |
36275524 |
T |
 |
| Q |
201 |
tcctcgttctaaacccgaaacgccaccgtttaaag |
235 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36275523 |
tcctcgttctaaaccagaaacgccaccgtttaaag |
36275489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University