View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16655_high_6 (Length: 277)
Name: NF16655_high_6
Description: NF16655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16655_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 124 - 262
Target Start/End: Original strand, 39918352 - 39918490
Alignment:
| Q |
124 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918352 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
39918451 |
T |
|
| Q |
224 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918452 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtat |
39918490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 13 - 75
Target Start/End: Original strand, 39918241 - 39918303
Alignment:
| Q |
13 |
agcagagataggcaatgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918241 |
agcagagataggcaatgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
39918303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University