View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16656_high_11 (Length: 246)
Name: NF16656_high_11
Description: NF16656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16656_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 26 - 231
Target Start/End: Complemental strand, 11041443 - 11041238
Alignment:
| Q |
26 |
gtgtggtcaggaccgacataagcttcaagagaaacaagcccttacttactttagtctttaggttcctcaacctacccaactcagctatctgcctagccca |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11041443 |
gtgtggtcaggaccgacataagcttcaagagaaacaagccgtcacttactttagtctttaggttcctcaacctacccaactcagctatctgcctagccca |
11041344 |
T |
|
| Q |
126 |
tagcctcgactttattttgatcctgacaaaaatattatgtatgatgcctcctcatatattttttcattgttagatctcacctatcttaaagcctcacttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11041343 |
tagcctcgactttattttgatcctgacaaaaatattatgtatgatgcctcctcatatatttgttcattgttagatctcacctatcttaaagcctcacttt |
11041244 |
T |
|
| Q |
226 |
gccttt |
231 |
Q |
| |
|
|||||| |
|
|
| T |
11041243 |
gccttt |
11041238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University