View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16656_high_4 (Length: 413)
Name: NF16656_high_4
Description: NF16656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16656_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 1 - 389
Target Start/End: Complemental strand, 52324916 - 52324528
Alignment:
| Q |
1 |
gattatgtttatgctgcgggcattggtatttatgggtatatgtggggaagaaaagcggtaacatcaaaacgccaatgaaaaagcttatttcctaaccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
52324916 |
gattatgtttatgctgcgggcattggtatttatgggtatatgtggggaagaaaagcggtaacatcaaaacaccaatgaaaaaccttatttcctaaccaat |
52324817 |
T |
 |
| Q |
101 |
cttctccttcacagtaaacatctcatctcacacagttaagagatggctgcagatgtaggatgctgtggaactaaattctggctatacatattgatgatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52324816 |
cttctccttcacagtaaacatctcatctcacacagttaagagatggctgcagatgtaggatgctgtggaactaaattctggctatacatattgatgatca |
52324717 |
T |
 |
| Q |
201 |
taggattagtatgcttcgctggtcttatggctggtctcactcttggactcatgtctttaggtctcgtcgaccttgaagttctcatcaaatctggtcgccc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52324716 |
taggattagtatgcttcgctggtcttatggctggtctcactcttggactcatgtctttaggtctcgtcgaccttgaagttctcatcaaatctggtcgccc |
52324617 |
T |
 |
| Q |
301 |
tcaacatcgcatccatgccgccaaaattttcccagttgttaagaatcagcatcttttgctttgtactcttttgatcggaaattccttgg |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52324616 |
tcaacatcgcatccatgccgccaaaattttcccagttgttaagaatcagcatcttttgctttgtactcttttgatcggaaattccttgg |
52324528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 209 - 282
Target Start/End: Original strand, 48667347 - 48667420
Alignment:
| Q |
209 |
gtatgcttcgctggtcttatggctggtctcactcttggactcatgtctttaggtctcgtcgaccttgaagttct |
282 |
Q |
| |
|
|||||||| |||||| | ||| | |||||||||||||| ||||||||| | ||||||||||||||||| |||| |
|
|
| T |
48667347 |
gtatgctttgctggtatcatgtccggtctcactcttggtctcatgtctctcagtctcgtcgaccttgaaattct |
48667420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University