View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16656_low_10 (Length: 346)
Name: NF16656_low_10
Description: NF16656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16656_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 19 - 137
Target Start/End: Original strand, 25118153 - 25118271
Alignment:
| Q |
19 |
atacttaaggaagttattttgtagtagtatgtatttagaagatttcttttgttatcaaaaagtttattgtcattaaaacttatgactaggaagattggtg |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25118153 |
atacttaaggaagttattctgtagtagtatgtatttagaagatttcttttgttatcgaaaagtttattgtcattaaaaccaatgactaggaagattggtg |
25118252 |
T |
 |
| Q |
119 |
ccataaaagagtatattat |
137 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25118253 |
ccataaaagagtatattat |
25118271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 100 - 128
Target Start/End: Original strand, 25118304 - 25118332
Alignment:
| Q |
100 |
atgactaggaagattggtgccataaaaga |
128 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25118304 |
atgactaggaagattggtgccataaaaga |
25118332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University