View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16656_low_14 (Length: 281)
Name: NF16656_low_14
Description: NF16656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16656_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 110 - 255
Target Start/End: Original strand, 12433926 - 12434066
Alignment:
| Q |
110 |
ggttgcatgaaaagggttttgctaattttattatattttttcactc--acttataaaacctgacaccccttttcataaagttcggattttttgtatgatt |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12433926 |
ggttgcatgaacagggttttgctaattttattatattttttcactctcacttataaaacctgacaccccttttcataaagtttggattttttgtatgatt |
12434025 |
T |
|
| Q |
208 |
ttgatcacagtttggattttggattttccgttaagattcttgataaag |
255 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12434026 |
ttgatcacag-------tttggattttccgttaagattcttgataaag |
12434066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University