View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16657_high_4 (Length: 325)
Name: NF16657_high_4
Description: NF16657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16657_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 309
Target Start/End: Original strand, 32554170 - 32554461
Alignment:
| Q |
18 |
acttctgtaccttcttatgttcctttgaacccttcttctccttcttgcaattatcttggtcctgccggcatggcggcatacatgcctaatggttctctta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32554170 |
acttctgtaccttcttatgttcctttgaacccttcttctccttcttgcaattatcttggtcctgccggtatggcggcatacatgcctaatggttctctta |
32554269 |
T |
 |
| Q |
118 |
ctactgccttgtctactgatagttctggtttgtttggaggaaatatggtttttagttctgaaattcagacacaagaacttgattatcaaggagataatgg |
217 |
Q |
| |
|
| ||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32554270 |
ccactgctttgtctactgatagttctggtttgtttggtggaaatatggtttttggttctgaaattcagacacaagaacttgattatcaaggagataatgg |
32554369 |
T |
 |
| Q |
218 |
tagaatttattgtcctgatcctattcagagggtgtttaaccctcctgaccttcaggtattgactgtttctaaactacttagttaatttcttc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
32554370 |
tagaatttattgtcctgatcctattcagagggtgtttaaccctcctgaccttcaggtattggcaatttctaaactacttggttaatttcttc |
32554461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 230
Target Start/End: Original strand, 16921639 - 16921697
Alignment:
| Q |
172 |
gttctgaaattcagacacaagaacttgattatcaaggagataatggtagaatttattgt |
230 |
Q |
| |
|
|||||||||| ||||||||||| | ||||||||||| || |||||| ||||||||||| |
|
|
| T |
16921639 |
gttctgaaatgcagacacaagatttggattatcaaggtgaaaatggtggaatttattgt |
16921697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University