View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16657_low_7 (Length: 303)
Name: NF16657_low_7
Description: NF16657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16657_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 15 - 296
Target Start/End: Complemental strand, 11019872 - 11019591
Alignment:
| Q |
15 |
aacaagagctttttgggcttggacaagggtggcatcaacttcgaaaccaagagccacaatgggatcaagaacactcttgaggaagtgtggttgaacggtt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019872 |
aacaagagctttttgggcttggacaagggtggcatcaacttcgaaaccaagagccacaatgggatcaagaacactcttgaggaagtgtggttgaacggtt |
11019773 |
T |
|
| Q |
115 |
tgttcacaaagggtagggttggaggnnnnnnngcagaaattcaagagatcaggttttagatcgtgatgtacgacatgtatatcgtgagactcagcagtgg |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019772 |
tgttcacaaagggtagggttggaggtttttttgcagaaattcaagagatcaggttttagatcgtgatgtacgacatgtatatcgtgagactcagcagtgg |
11019673 |
T |
|
| Q |
215 |
cattgccaattaaaaggaatgagacaagggttatagtgaagagaacatttttacatgtgaaattcatattgtctcttctctg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019672 |
cattgccaattaaaaggaatgagacaagggttatagtgaagagaacatttttacatgtgaaattcatattgtctcttctctg |
11019591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University